Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0579
Clone ID AL0579
Vector pGT0lxr
Project sanger

Sequence tag AL0579
Sequence
ATTAAAGATCTCCTTACAACACGCCTTGTATCTTTTACATCATGGAATGCTTGATGATGCGAACAGGAACCTGAGTAAGG
CAGAGACGTGGAGGTATGGAGAAAAGTCGTCTTCTCAGGAAGTGTTGATCAACCTTGTTCAGGCTTACAAAGGGCTTCTG
CAGTACTACACTTGGACCAGAAAGAAGATGGAGTTGTCAAAGCTTGATGAAGATGATTACGCTTACGCCGCCAAAACCCG
ATCCACGCTCAGCCAGAGCTGCAAGACGTCTACAAATATCCGTGCAGGGG
Sequence Type mRNA
Unitrap ID UNI2660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 373949..376047 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]

 
Come back to gene ENSMUSG00000072258


For any suggestions or comments, please send an email to unitrap@crg.es