Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14329D3
Clone ID IST14329D3
Vector VICTR74
Project tigm

Sequence tag IST14329D3HMF1
Sequence
TTTGGTGAGACCCAGNCAGTGAGTGACACTTAGAACAGCAAACCAGTTTTTATTCATAATAGACTCACCTATCAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338908..24338984 75
NO GENE  


Sequence tag IST14329D3HMR1
Sequence
ANAGGCTGCCCTTCCCTTCAATCTACNNGCCTCATCTTGAGTCACTTTGTTCCTTTGTGCTAGTTTCTGACCATCTTTCT
CAGCAGGGCCCTTTCCAGCACACCTGCCTTGGAAGCTTGTGGACCTTTANAAGGAGTGGGTTATGGGACATACTCCCACC
CTAGGACCTTCTTTCTTCCTGGGCTCTTCCAGCCTTGCTCCCAGCACAGCACACAAAGGACACTGTCCTAGCATCTCANT
TAATCCCAGGTCTTTGGGCTTCTTGGANCCTGTNNNCTNANCTATT
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338626..24338908 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es