Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13230G11
Clone ID IST13230G11
Vector VICTR74
Project tigm

Sequence tag IST13230G11BBF1
Sequence
TGTTCACGCTTGCCGGCGTTTGCTGCGTGTGTAGATGGCGTTAAAGGCAGATGCGTCTGAGCACCAGATAGAAAATACTT
CTCTATTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91226160..91226253 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039830 (Olig2) NM_016967 oligodendrocyte transcription factor 2 Gene [Source:MGI (curated);Acc:Olig2-001]

 
Come back to gene ENSMUSG00000039830


For any suggestions or comments, please send an email to unitrap@crg.es