Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13264D7
Clone ID IST13264D7
Vector VICTR74
Project tigm

Sequence tag IST13264D7HMF1
Sequence
AATGTTTATTTACTATTTTAAAAGGTGAATGATTTCATTCCTTAAGTTAGTACTTTTAAATATTTTGNCTAAAGATAATA
TTTCCTTTATGATATGGTTTTTCTGATTAATTCTGTAGTAACAGGGAATAATAGCTAACATTCATTGAAAATGCACTATA
GCCAACCATTACTCCAAGTGCTGCACTTAAATGATCTCTTAGAAGACTTCTAGCTTAGTCAGTTCCACATANTGTCTCAG
ATTAATATGCCNNNNGTCTCGTAGCTAATATTGTACTGNNCTGTACTTTACTGTNTTGCTGTATTAGTCAGAGTTCTCTA
ANGGAACAGAGTTGATAGGATGAAAAATGTATGTATAANGGGATTTATGAGAGTGTCTTACGGGCGAC
Sequence Type genomic DNA
Unitrap ID UNI27273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13587301..13587687 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]


Sequence tag IST13264D7BBF1
Sequence
CTGAGAGGGTTAAAGCACGGAAGGTAACAGGTGTGAGGGCAGCATGGGGAGAGTCTATGTTGAACAGGGAGATTCTAACT
CAAACAAACAAACAAAAAATCCCTTTTTCTGAGAGGACCCCAAAGGGTTCAATAATGTGTCAAAAACACACATACCAAAA
CGTTAAGTCTTGTCCCTCTTTGAAGGGACCGAAGCAAAAGCTAACTCAATCATTCAACTATGGATAAATTTAGAAAGCAT
CAAAAAATGTACCTTAGGAGTTTGGAAAGATAAAATGAGCTTTCACTTAAATTTTTTCCCTGACAATTTCCTCATTATAA
ATTTGACATTTTCATTAAAGTCTAAGTAATCNTTATNCNAAAGGCNNAANCCTCTACNCTACCNTATNANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97127711..97128097 371
 
EST/CDNA Est Name
  BU583566.1 - CN680136.1 - DT921180.1 - CN673689.1 - CN678233.1 - CB951702.1 - CX201427.1 - AA549145.1 - AI153132.1 - CJ080230.1 - BF012239.1 - CJ083437.1 - CJ079894.1 - BY054399.1 - BY067568.1 - BY150403.1 - BY148671.1 - BY148715.1 - BY329885.1 - BY263290

 
Come back to gene BU583566.1 - CN680136.1 - DT921180.1 - CN673689.1 - CN678233.1 - CB951702.1 - CX201427.1 - AA549145.1 - AI153132.1 - CJ080230.1 - BF012239.1 - CJ083437.1 - CJ079894.1 - BY054399.1 - BY067568.1 - BY150403.1 - BY148671.1 - BY148715.1 - BY329885.1 - BY263290


For any suggestions or comments, please send an email to unitrap@crg.es