Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14915G11
Clone ID IST14915G11
Vector VICTR76
Project tigm

Sequence tag IST14915G11HMR1
Sequence
TTCTGAGCGATGGCTACCAAAGTGTATGTAACTCTAAGCTGTACCGTGTGCCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94006274..94006328 55
NO GENE  


Sequence tag IST14915G11HMF1
Sequence
AGAGCAAAGTACAGATCTCAGGCTTACCCGGAAGCTCCCTCAAACCCTCCAGCCGACTGCCTCTCTCCTCAGCCCTTTCT
GGTTCCCGTGTTTCCTTTGTCGTTGTTTATCCTTCCTGTAATGGGATGAACTGCCTGCAGTGCTTTGGGGTTTGCGTTCT
GTAGCTTGAGACGTTGAACTTGAGGTTTGCCTGCCCAGTCAGATAGTTCCCAAATCATTTCTCTTCGTACANAANAGTAT
TTCATTGTAAGGTGATTACATTTCCAGTTTTAGCAGCAGGTGTGACAAAGACCCCCAGTCTCCATGAATGACTTAGATAC
TTTTGTATCCNAGCACGGTGTGCTGGTCTATCGTCAAGCTTGGTGGAATCCGGTAATGTTA
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94005897..94006276 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es