Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10684G12
Clone ID IST10684G12
Vector VICTR76
Project tigm

Sequence tag IST10684G12HMF1
Sequence
CTTTTTCTTTTGTCTTTATTCCNTTTGGTTTTGCTTCTTAGCCTTANGAATTGAGGTCACTGTCTTTTATAGTTCTAGGC
TCAGTGTTCTTAGTTTTAGTATTTTTAAAACTGTTTAGAAAGAGGTTTTCTGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649079..66649214 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST10684G12BBF1
Sequence
TTATGTCTCCTGTCTGGAACTGAAGTTTGCAAGCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133453980..133454019 40
NO GENE  

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es