Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10322C9
Clone ID IST10322C9
Vector VICTR76
Project tigm

Sequence tag IST10322C9HMF1
Sequence
CAGGGGAACACCAGGGCTAANNNNNNNNNNNNNNGAGTAGGGGAGTGGGGGGGAAGGGTGTGGGAGACTTTTGGGATAGC
ATTGGAAATGTAATTGAGGAAAATGCGTAATAAAAAAAGAAAGAAAGAAAAAAAAAGANNAANCAAANCAAAAACAACAA
AACAAAACCCAANANANAANAAAAGAATATATNAAATANCCAAATGTGCTTCATTCATCTGTNGGCNCAGGCNAAGTCCC
AGTTTTGGGCGCANCCCGTCTTTGTCTGCCTTTGTTATCANCANCCANCTCANTAGGCCTTGNGGGCANNCTGTGCTCTG
CTNNCGTTCTCACGGCCAGGANAGCTGGGAGGTCTCTCTTTGCTGGGTACCCTGAGGGTCTGANAACACATGCTGCATTA
CCTCCTAACTAGGCACTCNANAGGGGAAGGATCCTGCTCACCAGCNCCGANGCANGTGGANGGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10322C9BBF1
Sequence
CAGGGGAACACCAGGGCTAANAATGGNAATGGGTGAGTAGGGGAGTGGGGGGGAAGGGTGTGGGAGACTTTTGGGATANC
ATTGGAAATGTAATTGAGGAAAATGCGTAATAAAAAAAGAAAGAAAGAAAAAAAAAGANNNNNCAAANCAAAAACAACAA
AACAAAACCCAANANANAAGAAAAGANTATNTAAAATACCCAAATGTGCTTCATTCATCTGTNNGCNCAGGCNANNTCCC
AGTTTTGGGCNCANCCCGTCTTTGTCTGCCTTTGTTATCANCANCCANCTCANTAGGCCTTGNGGGCANACTGTGCTCTG
CTCACGTTCTCNCGGCCAGGANAGCTGGGAGGTCTCTCTTTGCTGGGTACCCTGAGGGTCTGANNNCNCNTGCTGCATTA
CCTCCTAACTAGGCACTCANGAGGGGAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10322C9HMR1
Sequence
ANGGCCGACTAGGCCATCTTTTGATACATATGCAGCTAGAGTCAAGAGCTCCGGGGTACTGGTTAGTTCATAATGTTGCA
CCTACAGGGTTGCAGATCTCTTTAGCTCCTTGGATACTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGATCCATCCAATA
NTTC
Sequence Type genomic DNA
Unitrap ID UNI33028 UNI35034 UNI35035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 60634843..60635003 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 112715390..112715550 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 48543122..48543282 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 95872134..95872294 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 120086724..120086884 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 67567162..67567322 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 70887868..70888028 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8543821..8543981 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 82226740..82226900 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84771030..84771190 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7445740..7445900 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 101529042..101529202 159
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 71164480..71164640 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036356 (Csgalnact1) NP_766341 chondroitin sulfate N-acetylgalactosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2442354]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 68678459..68678619 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032238 (Rora) NM_013646 RAR-related orphan receptor alpha Gene [Source:MGI (curated);Acc:Rora-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 36207238..36207398 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051361 (6030498E09Rik) NM_183126 RIKEN cDNA 6030498E09 gene Gene [Source:MGI Symbol;Acc:MGI:1925133]

 
Come back to gene ENSMUSG00000051361


For any suggestions or comments, please send an email to unitrap@crg.es