Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10073A6
Clone ID IST10073A6
Vector VICTR75
Project tigm

Sequence tag IST10073A6BBF2
Sequence
ATGGTGGCTCACAACCATCTGTAACTAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54782513..54782545 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62554446..62554478 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35528134..35528166 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77280807..77280839 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5520251..5520283 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28574034..28574066 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026807 (1190002A17Rik) NM_001033874 RIKEN cDNA 1190002A17 gene Gene [Source:MGI Symbol;Acc:MGI:1916120]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 57209170..57209202 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7682020..7682052 33
NO GENE  


Sequence tag IST10073A6BBR1
Sequence
CCATGTGGTTGCTGGGATTTGAACTCAGGCCCTTCGGAAGAGCAGTCAGTGCTGTTAACCTCTGAGCCATCTCACCAGCC
CCCTATTTTAGTTTTTTTATATTAAAACTTGGATTTAGTTGTAAAACTGTTCATAAGTTGTAGTTTATAGTATTTTCCCT
GGTGCTTTTGTGCTTGTGAATTTGAGAACATCTAAATTGCCAAACTTGAGAAACAGGATTGTTTTTTATGTTAATAGTAC
ACAGGTAAAGGAATAACATTTGACAACCAACGCAAACCTTGGAGTTATGTTTTCACTGAGAAGTCTTACTCTGAAGATGT
TTAAGAGTGAAGCAGAATGAGTTTTCATAGGTCGGTCTATTCCATCACCAAAGGAGAGTCCCTGTGCACAACCCATAACA
TCCAGCCCTTGTTGTCTCCTCTTCCTCCTCGTGCTCCCTTCGCTGCCGCTGCTGTCCCCTTCCTCCCCACAGCCAGCCCA
AGGCCTCTCCCGTGGCTTTATATGCAGCGTAAGGTGTTTCCCTAGTTTTTTTATTTTTTTAACATCTTAAGTTTATGACA
CACAGCCGGCATCCCCTAGATTTATAAAACTACAGACAGAATGAAG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97859379..97859983 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es