Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0566
Clone ID AL0566
Vector pGT0lxr
Project sanger

Sequence tag AL0566
Sequence
CCTCCACCCTCATGACGGTACCCTTCCTCCCTTCAGCACTCTATTATTTCCCCCATTATTTTTCACCGCATTATTTGCCT
TATCCGCCCCCGCTTATTTATCTTGCCCGGTATTCTGCCTTCATTCTTCGAACAGGCACGTCGAGCCCATGAGGAGGCAC
GACGGCGCCAGGAGCAGCAGCAGCAGCAGCAGCAGCAGAGACAGGAGCAGCAGCAGCAGCAGCAGCAGGCAGCTGCTGTG
GCCGCTGCCTCTGCCCCCCAGGCCCAGAGCTCCCAGCCCCAGTCTATGCTGGACCAGCAGAGGGAGTTGGCCCGGAAACG
AGAGCAGGAGCGGAGGCGCAGGGAGGCA
Sequence Type mRNA
Unitrap ID UNI2664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32334976..32335194 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es