Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12182G3
Clone ID IST12182G3
Vector VICTR76
Project tigm

Sequence tag IST12182G3HMR2
Sequence
CTTGGGGTATTTCCCGGTCATTTGGGGAAACTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88751739..88751772 34
NO GENE  


Sequence tag IST12182G3BBR1
Sequence
NCTAGCAGCTACATCCTACCCTTATGCTGTCCCCGTTCCAAAAGGCCATAACTCTCCTGCTTCTACTCTTCCTCCTTCCN
ACCCCGAAGTCCCGCCTACTCACCCAGTGATTGGCTCCTTTATTCATTAGGGGATTGGTTCCCAAGAACAGCACCAGGCC
CGTGCACAACAAGGAAGCTTCAGTGGCTCTTCCTCTCTGTCTTCCCTGCTCTCTCTCCCTCAGTTGTCCTACCTGATAGC
TTGAACAAGGGTGCAGGGTACATAAGGAAAGATGGAACGCTGGCCAGAANCAATTTTACTAATTGGAGTTTATAGCAGAT
ATTANTTCCTTTAANAANACAGGANATCC
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115500888..115501234 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es