Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10126B1
Clone ID IST10126B1
Vector VICTR76
Project tigm

Sequence tag IST10126B1BBF1
Sequence
TATGTAACTAGTTATCAGCCTCTCTGTAACAGCTCCCATCTGCAGGAAGGAGGCAATCACATGCTCAGGCTATTGTGTGA
AATAAATGGGTGAATTAATTATTGTGCTTAAATTAGTGTCAGTTACACACTTCTGTTTTCTAGTGTCTGGGGGATATTCT
GAATTTCTAGAACTGACATTAATACTTTATTGACAGGGGTGTTCCTGATCTACTTTGTGAAGAGGCACGAAAGCAAATAA
AACAGGAAACTGGGAGGAAAGAAAATACAGAGTCCAACTCTCTAGGACCTAAATAGTCTAATAGCCAGTCGGGGATGGAG
ACATTCCTGCCCGGATTTAACTCATCAGTAAATTCTCAGAATTAAGAATGTAAAGTCGGCTGATTTGCCCTAGGGAACAA
CGTGAACCCGCACACACCATGCAAGGTCACATTCTTTCAAGGGGGCAGAGACAGGCACGTTCACTCCTTTAACTGCCTCA
TATTGTCATATGAATGTTCCCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56871302..56871804 501
 
EST/CDNA Est Name
  BY728735.1 - CF896873.1 - CA535754.1 - CD539421.1 - BG078279.2 - CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516


Sequence tag IST10126B1BBR1
Sequence
CATACTAGCTGATACCAGGACTACAAACCCAGGCAGAGCGGTTGGAGTCGTGGCCCTAACTGCTGGGCTATACTTGTTTG
CCCTTCATGACACCTTATGTAGGTGGTCTCACACAAGCCCTCATTCTTTTCTTTCCCAGTCTAGTTTTTCACAACTCACC
CCCCTCCCCAATACTTTCTTGCCTTCTGGCTCTTTCAGGCATTTTCTAGGACAGTGCTATAGACATGTCTGTCAGGGCAA
CTGCTAGTGGTCCCTCTGACTGTTCTTCCTCCTTTTCAAGGGTAATAGCTAACTTTTCTATTTGTCATATTAGGGCTTTG
GGAGCTCTCTATGTTGCCCCCTCCATCCTTAGAGTAAGCCAAGGAGATAAGAGAGATGTGGTGATTAAAGGATTGGCAGC
TCTTGGCTCTGTGACCTTGGGCATATTCTTAACTTCTACCAACTTTAGGCTTTTTATCTGTATAATGAAGACAGTAATAG
GTAGATACCCAATGGAAGTTAGGGATGTAAGCATTAAATGAATTTATATATGCAAAACATACATACTAGTACTCGTATGC
ATAATAAATCTTAGTCTTAT
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56870726..56871305 580
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es