Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10609D6
Clone ID IST10609D6
Vector VICTR76
Project tigm

Sequence tag IST10609D6HMF1
Sequence
GTTTCTGCTCTCAGGGGACCTAAGTCTCGAAGGAAGCTGGCAATTGATAANAAACTATAATAAAATACAAGGTAGAGACT
ATTCACAGCAGGCACACCCTACAGAGAAGTCGAGAATGAAGTAAAAGCTGAACAGACATGAAAAAAGATCAGACTTTAAC
AAGGGGTAATTGAAAGACCAAGCAGCCAAGGCAAGGTCAGCATGGCTAAGCACTTAGTGTTCCAGGACCGTGTAGCTTGG
TAGTGATCAAGACACAACCAAATAGGCAAAAACAAAACCCCAAACTTAAAGAGCCGATCAGGTCACACCACCNNCTGGCA
CANGAANCANTTAAGTGTCCAANAAGAAAAATCANTGGCCTATCACTGGTGCANTGTACGGAAAAATGGATGCNNGAGGC
CNATTCCTTTCTTGGATCNAATTTTANTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77383007..77383437 403
NO GENE  


Sequence tag IST10609D6HMR1
Sequence
GCCCTGGCACACAGATACATTGGAAAAGTACTGANGANGAGTGTTGCAAGATACCTGATCACACTGTGAACCCCAAGGAT
GCGTTACTTACTCAAGAGTGCTGTTTCTAGTTGTGATGTANGTCAGCCCGTGGCACATATCTTTAATCCCAAACAGCAGT
AAAGTTAGTTTGTAGAAGGAAGCANCCATGTTTGAAAGTGATGTCTAATTTGAGTGGCNNGCAATCTGATGAATCANAAA
GATTN
Sequence Type genomic DNA
Unitrap ID UNI15132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77383466..77383709 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]


Sequence tag IST10609D6BBF1
Sequence
GTTTCTGCTCTCAGGGGACCTAAGTCTCGAAGGAAGCTGGCAATTGATAAGAAACTATAATAAAATACAAGGTANAGACT
ATTCACAGCAGGCACACCCTACAGAGAAGTCGAGAATGAAGTAAAAGCTGAACAGACATGAAAAAAGATCAGACTTTAAC
AAGGGGTAATTGAAAGACCAAGCAGCCAAGGCAAGGTCAGCATGGCTAAGCACTTANTGTTCCNNGACCGTGTAGCTTGG
TAGTGATCAANACACANNNNNNTNNGCAAAAACNAAACCCCAAACTTAAAGAGCCGATCANNTCACACCANCNNNTGNNN
NANGAAGCAGTTAAGTGTCCAANAANAAAAATCAATGGCCTATCACTGGTGCAGTGTACGGAAAAATGGATGCANGANGC
CNATTCCTTTCTTGGATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es