Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12419E5
Clone ID IST12419E5
Vector VICTR76
Project tigm

Sequence tag IST12419E5BBF1
Sequence
TTGTCCCATATTACTACTAGCGTAAGTCCATTAAGCACTTGAAATGTATTATTTTTATACTAACTTTTTATTGAAAATTT
CTGANCTTCACATCATGCACCCCANTCCCACTCATCTCCCCATCCCTTTGTATCTGCCCTTGCCACCTCCTTTCCTTCTC
CCACAAGAAAGTAAAAAGCAAAAAGAATAAAATTTAAAACATAAGAAAACATCCGGTTATGGTAGCTGTAGTGTGTCACT
GTGTGTCCACTCAGCTTTCCTTGCAAATGCTCATTGCCATGAGTCATTGGTGTGGTTAGAGGACCTGGCTTCTGCTACAC
TATCAATACTGGATCCN
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30449761..30450096 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]


Sequence tag IST12419E5HMF1
Sequence
TTGTCCCATATTACTACTAGCGTAAGTCCATTAAGCACTTGAAATGTATTATTTTTATACTAACTTTTTATTGAAAATTT
CTGANCTTCACATCATGCACCCCANTCCCACTCATCTCCCCATCCCTTTGTATCTGCCCTTGCCACCTCCTTTCCTTCTC
CCACAANAAAGTAAAAAGCAAAAANAATAAAATTTANGACATAGNAAAACNTCCGGTTATGGTAGCTGTNNTGTGTCACT
GTGTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es