Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13066C11
Clone ID IST13066C11
Vector VICTR76
Project tigm

Sequence tag IST13066C11BBF1
Sequence
TTCCTTTCCTCCTCCCTTTTCCCCTCCCTTAACTCTTTGAATACTGTGCTGTGGGTGAATTGCTTTCAGGACTTGCTGTG
AGCTGTCATGCTGAAATAGTCTTGTTTCCTTTCTTTTTCTTACATTAGTCCTACTTTTCCTGGGCTACTTTCTAGACTCT
GCATTCCTGAGTCTTCTACCATCAGAAGGATGTTTCTATGGAACCNGAAACATCCTCAGGGGTTTCTCCTANNTGTAACA
TTTNNTTGGGATCCTCCNGCNTTTCCTTCCTGGCNNNNNNNTCCNGNNNTTGACATCTGTTCTTGGGCTCTTGGAAAATC
TGGCTGCTANGCCTGCTGGTCTAACTCTTTGACTCTTCNACTCNNTCNCCCTCAGTTTTTTNAGAATCCTATNNTCNATT
TCTTTANCCTCNCNATTGAATCTTTTAACTTCANAACTCNACATTTTTTTNNANTGNNNTNTTTTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13066C11HMF1
Sequence
TTCCTTTCCTCCTCCCTTTTCCCCTCCCTTAACTCTTTGAATACTGTGCTGTGGGTGAATTGCTTTCAGGACTTGCTGTG
AGCTGTCATGCTGAAATAGTCTTGTTTCCTTTCTTTTTCTTACATTAGTCCTACTTTTCCTGGGCTACTTTCTAGACTCT
GCATTCCTGANTCTTCTACCATCAGAAGGATGTTTCTATGGAACCAGAAACATCCTCAGGGGTTTCTCCTANATGTAACA
TTTCATTGGGATCCTCCTGCTTTTCCTTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44778702..44778974 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es