Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13375A12
Clone ID IST13375A12
Vector VICTR74
Project tigm

Sequence tag IST13375A12HMF1
Sequence
GGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTC
TTGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI13304 UNI23476 UNI26702 UNI35040 UNI35041 UNI35042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 75245616..75245706 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026204 (Ptprn) NM_008985 protein tyrosine phosphatase, receptor type, N Gene [Source:MGI Symbol;Acc:MGI:102765]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79205402..79205492 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30749118..30749208 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56207237..56207327 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021020 (Srp54c) NM_011899 signal recognition particle 54A Gene [Source:MGI Symbol;Acc:MGI:1346087]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 45100967..45101057 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38729091..38729181 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10823346..10823436 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7095483..7095573 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31622548..31622638 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026842 (Abl1) NM_009594 c-abl oncogene 1, receptor tyrosine kinase Gene [Source:MGI (curated);Acc:Abl1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86681641..86681731 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028078 (Dclk2) NM_027539 doublecortin-like kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1918012]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44871234..44871324 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121759440..121759530 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 31344102..31344192 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16841217..16841307 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386088..127386178 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31183280..31183370 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042496 (Prdm10) NM_001080817 PR domain containing 10 Gene [Source:MGI (curated);Acc:Prdm10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 119115177..119115267 91
NO GENE  


Sequence tag IST13375A12BBF1
Sequence
GGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCNGGGCTACNCANNNAAACCCTGTC
TT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042496


For any suggestions or comments, please send an email to unitrap@crg.es