Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11667A10
Clone ID IST11667A10
Vector VICTR76
Project tigm

Sequence tag IST11667A10HMF1
Sequence
CAGTTACTTACAAGACCAATTNACACACACNTACAAAAATCAATTCTGACTTAATTTTTATCACTNNAAATTCTTTCAGT
ATCTGGAGGCNNANTNNNTTTGACACANNTGATTATACTTTTAAGAATAAAAGCTAAGAGTTTCCCNTNNNTTTGCTGTT
CTAGTCTGTCATAGCAGTTATNCACNTGGGATAATATTGGGCCATTGNNCATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11667A10HMR1
Sequence
CTGTTATAACTAAATTACAATAATGAACAATAATGATGGTGACAATTACGAAAATGATGATTGATGATGATGATTATGAG
ATAAAATCTCACTATGCAGCCCTGGCTGTCCTGGACCTTACTATGTAGACCAGGCTGGCCTTGAACTANNANAGCCNTTT
GCTTCTACCTCCN
Sequence Type genomic DNA
Unitrap ID UNI22841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70322982..70323153 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST11667A10BBF1
Sequence
CANTTACTTACNANACCNATTTACACACACNTACNAAAATCAATTCTGACTTAATTTTTATCACTANAAATTCTTTCATT
ATCTGGAGGCAAANTCANTTTGNCACATCTGATTATACTTTTAANAATAAANNCTAANAGTTTCCCATTAATTTGCTGTT
CTANTCTGTCATAGCAGTTATACACATGGGATAATATTGGGCCNTTGTACATAGAGAANTGTGTTTTGTCCCTCCTGCAT
GGTCCANACATTGTTCTTGGTGCCTNATGTNTNAATGTCTTATGAGTTGGATTTAATNNANGTTTGCAGTTAATGTTTTC
ACTANTTAAAAATGCTNANANCTTCACAAAAAGAATAAAAGCTNAGAGAACTTGGCTTGAGAACTGGGTGTGANCACNGT
TTCNCTGTGCNACTGCACTCCANCCTNNTNNNNTGANGNANCAGCGGGGNTGCTGGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es