Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10908F11
Clone ID IST10908F11
Vector VICTR76
Project tigm

Sequence tag IST10908F11BBF1
Sequence
CTCTGAAGCNNNAGAACAATGGCTGAAAAAACAAGTGCAGCCGACTCACGCAGCCACCGCCTGGCCACATGCACGCACAA
CTCCCTGGGGCTGAACTCAGCGCCGCGGAACCTGACAGCCTAACGCCCTTACTGGGGCTCACTGTCCTTCCAGCCACCCG
CGGTCAGCANCCCANANAGGCCCAAGGGATGAGGACACCACAGAGCGCTGTGACGCCCTCGCTGCAGGAGCCGGGCCGAG
CCTGACGTCTGTCCTCTCCAAGTGCGCACCGGCCCCCGANGGAGCGGCCGGCNNNNGGCTGCCGCATGGAACGTCTGCAN
ANNGTGANCGGCTTGCACCCCGGGCCAGGGTGGGGACCGCTGCTCTCCCANGTCCGTGCTAGAGTCGCCGGCGCCACCTG
GTGGCCNCCTCCACGTANCACGCCGGGTTTCCCCACCCCACCCNNNNCCATCCTGANGCCTNNGGCAAGNNCCACTCCCA
CACCCTCNCACCCNCGCNCATGCCCCACTCCGNNNCCTTT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10908F11HMF1
Sequence
CTCTGAAGCCNGAGAACAATGGCTGAAAAAACAAGTGCAGCCGACTCACGCANCCACCGCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71018305..71018368 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST10908F11HMR1
Sequence
AGAGGAAATGACGGCAGGGGTCANCTGGCATCCCAGGGTGGACAGACGGCTATATCCTCAAGCTTGTCACCCCTGCCCTG
GCCCTGCTCTGGCCCGGGCCCTCTCCCAAGTGGTGCTGGCCCCTCCCACTCCAGCCACTGGTTTCACTCCCCANAGTTTG
CTCANCCAAATCTTTATTTTCCCCANAAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71018365..71018556 184
 
EST/CDNA Est Name
  W70832.1 - BE861264.1 - W54597.1

 
Come back to gene W70832.1 - BE861264.1 - W54597.1


For any suggestions or comments, please send an email to unitrap@crg.es