Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14523A10
Clone ID IST14523A10
Vector VICTR74
Project tigm

Sequence tag IST14523A10HMF1
Sequence
GTCTAAGTTTCCTTAATTGCAGATGATAAGATTCTATACATAAAAGATCCTAAAGATCCCACCNGGAAATGTATAATAGC
TAGTAAATACATTCAGCTGAGTAGCAGAATACAAAATTAACAAAAAAATCAGTAGCCTTCCTAAAAACAAACAAGCATAC
CAAAGAGAAATCAGGGAAACAATCAGAAAGCCTGCCCTACCCCCAATTGCATCTCTTGGAATAAATGTAACCTAAGCAAG
GTAAGAGTTCTGTTATAAAAAAATAAAAAATAAAAAACTTTAACCACTGAAGAAAGAAATGAAGAAAATGTCAAAAGATG
GAAAAGACCTCCCAGAGTCAAGCATTAATAGAGTTAATATAGTGAAAGTAGCCATCCTTTCAAAAGAAATTTAGACATTT
AAAGCNNTTCCAATCACAATCCCAACACAGCTCTTCACAGAAANGGGGCAGGGGTGGGGGANCTGAAATTTCATCNGGGA
ACATAAAAAAGTAAGACTAGCNNAAACCATTCTGAACAATAGAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82656721..82657246 510
 
EST/CDNA Est Name
  BM941850.1


Sequence tag IST14523A10HMR1
Sequence
CTTCTTTTTCTGTATGTAATCTCTTTTTTTCCTTCACTTGTCATGTTGCTTTAN
Sequence Type genomic DNA
Unitrap ID UNI5022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82657246..82657298 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]


Sequence tag IST14523A10BBF1
Sequence
GTCTAAGTTTCCTTAATTGCAGATGATAAGATTCTATACATAAAAGATCCTAAAGATCCCACCAGGAAATGTATAATAGC
TAGTAAATACATTCAGCTGAGTAGCAGAATACAAAATTAACAAAAAAATCAGTAGCCTTCCTAAAAACAAACAAGCATAC
CAAAGAGAAATCAGGGAAACAATCAGAAAGCCTGCCCTACCCCCAATTGCATCTCTTGGAATAAATGTAACCTAAGCAAG
GTAAGAGTTCTGTTATAAAAAAATAAAAAATAAAAAACTTTAACNNCTGAAGAAAGAAATGAAGAAAATGTCAAAAGATG
GAAAAGACCTCCCAGAGTCNAGCATTAATAGAGTTAATATAGTGAAAGTANCCNTCCTTTCAAAAGAAATTTANACATTT
AAAGCCATTCCNATCNCAATCCCAACACAGCTCTTCACAGAAATGGGGCNNGGGTGGGGGATCTGAAATTTNATCTGGNA
ACNTAAAAAAAGTNANACTANCCAAAACCATTCTGNNNATAGAANANNGNNGNNGGNNNNCNCCANCCCTGGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82656733..82657246 479
 
EST/CDNA Est Name
  BM941850.1

 
Come back to gene BM941850.1


For any suggestions or comments, please send an email to unitrap@crg.es