Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13065D8
Clone ID IST13065D8
Vector VICTR76
Project tigm

Sequence tag IST13065D8HMF1
Sequence
GGCTGGATCTCGGGGGACTTTTCCCCCTCTGCCCGCAAGAGGGACCCGTAAGATGAAAAGCGTTTCAAACACGGTCGGTC
CGGAGTTAGGGAAAAAAAGAAAAGAAAGAAAAATAAACAACAGAGTGAGACCCGCGGTCTGAGTACCGCTCCATCCATTC
ATGCGCTCAACTATTCAAACTGCCGGATGGTCGTGAGGGGTCCCGAGGGAATTCCATCCTTGAAAGTATGAGTTGGGCAA
GTGATGCGTGCTCGAGAGGCGCCCAATAAATGCTTTCACTTAATTATTTGAACGTTTGTTTTTTTCTGCTTATCACGATC
TACGAGTTGAATTTTGGTCGTTCNAAAAGTAATAAATTCNNTTAAAAGGGACACAGTTCAGCACTACCCAACTCTTATTA
CNGTTNCCN
Sequence Type genomic DNA
Unitrap ID UNI16694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131136095..131136502 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045427 (Hnrph2) NM_019868 heterogeneous nuclear ribonucleoprotein H2 Gene [Source:MGI (curated);Acc:Hnrph2-001]

 
Come back to gene ENSMUSG00000045427


For any suggestions or comments, please send an email to unitrap@crg.es