Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14866F6
Clone ID IST14866F6
Vector VICTR76
Project tigm

Sequence tag IST14866F6HMR1
Sequence
GGGCATATAAAGTTTGCAAGTCCAGTGGGCCTCTCTTTCCAGTGATGGCCGACTAGGCCATCTTTTGATACATATGCNGC
TAGAGTCAAAAGCTCTGGGGTACTGGTTAGTTCATAATGTTGTTNCACCTATAGGGTTGCNNATCCNNTN
Sequence Type genomic DNA
Unitrap ID UNI4411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38172377..38172522 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]


Sequence tag IST14866F6BBF1
Sequence
GCCCCAGTACAGGGGAACACCAGGGCCAAAAAGTGGGAGTAGGGGGGAGGGATAGCATTGGAAATGTAAATGAGAATACC
TAATTAAAAAGAGAGAGAGAGAGATGAAAACTAGGTAGTACCAACCAATCGCTCTGGAAACAAAACACCACATGCTTTCA
NAGTTTACAATTCCTAATATAAGAGAAGGATCNTAANAGTNNNNNNAACTNANATACNAGTGTTANTATTAGATCANCTT
GCNNANTNNNGTGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14866F6HMF2
Sequence
GCCCCAGTACAGGGGAACACCAGGGCCAAAAAGTGGGAG
Sequence Type genomic DNA
Unitrap ID UNI36358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6094737..6094775 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4662067..4662105 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 14312244..14312282 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 5119559..5119597 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020627 (Klhl29) kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6322621..6322659 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14451207..14451245 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5785686..5785724 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 6344876..6344914 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10893313..10893351 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 19314154..19314192 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8166916..8166954 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3473193..3473231 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 24922755..24922793 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4244238..4244276 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5636733..5636771 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18839969..18840007 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14589711..14589749 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5898738..5898776 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9871710..9871748 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 377921..377959 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 8598174..8598212 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 119899..119937 39
NO GENE  

 
Come back to gene ENSMUSG00000020627


For any suggestions or comments, please send an email to unitrap@crg.es