Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980A2
Clone ID IST14980A2
Vector VICTR76
Project tigm

Sequence tag IST14980A2BBF1
Sequence
ACATGAGGATGACATGAGGATTCATCTATGAACCAGACACTGGGCCTTCATCAGACATTGGACATGCTTCTGTCTTGATT
GTGAACTTTCAGCATCTATAACTGTAAAAGAAAAAAATCTTTAAAAAATAAACTACCTAGTTTATGATATTTTGTCATGG
CAGGCTGCATGGACTCAGAAGTCATCTGATATACACTAGATATACATTCACATCTACTANATATACACTAGTTATACACT
ANATGTACACTCACATCTACTAGATATACACTANATATACACTCACATCTACTANAACAAAGACTGGGTGCTTTGTTCAG
TCACAGGGGAATAAGAACGGCAGTGAAAGATCAAAAAAGTTCTGCCTCACTGGANAAGGAAACTGTTTATAGCTTGNATG
AGTATTCTCCNAAGACCTATGTGTTAAAGGCNNGTGGTGCNNNTGNGAAANGGTGNNANCTTTNNNANGTGAANCTACCT
GNGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14980A2HMR1
Sequence
TTGTGGTAGAAAGGGCAGGGCAGCTCTGACCTATTGTATAAGGGCTCTAATGTCCTTTGCAAGGGCTCCCTTTATGACCC
AATCCCTTTCAAACATTCCCATGTCCTAATGCCATCTATCATATTGATCATATTGGTAATCTGGTTTCTACCTATGACTT
CAGGAGACGTTC
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84778396..84778565 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST14980A2HMF1
Sequence
ACATGAGGATGACATGAGGATTCATCTATGAACCAGACACTGGGCCTTCATCAGACATTGGACATGCTTCTGTCTTGATT
GTGAACTTTCAGCATCTATAACTGTAAAAGAAAAAAATCTTTAAAAAATAAACTACCTAGTTTATGATATTTTGTCATGG
CAGGCTGCATGGACTCAGAAGTCATCTGATATACACTAGATATACATTCACATCTACTAGATATACACTAGTTATACACT
AGATGTACACTCACATCTACTAGATATACACTAGATATACACTCACATCTACTAGAACAAAGACTGGGTGCTTTGTTCAG
TCACAGGGGAATAAGAACGGCAGTGAAAGATCAAAAAAGTTCTGCCTCACTGGANAAGGAAACTGTTTATAGCTTGGATG
AGTATTCTCCAAAGACCTATGTGTNNAAGGCCTGTGGTGCTATTGGGAAATGGTGGCACCTTTAAGANGTGAAGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84777924..84778398 467
NO GENE  

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es