Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10248-NR
Clone ID PST10248-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10248-NR
Sequence
ATAGTAATAAGATTTAGTAATATAAAGTTATCTTCACATGAGGTGGCACACCTTTTGTTCCAGCCCTTGGGAGGCAGAGG
CATGAGGGATCTCTTGAGGACTTCCTGGTCTACATACTGCATTCTAGGACAGACAGAGCTACATAGTGAGACTCTGTCTC
TCTCTCTCACACACACAGACACACGCACGCACGCACGCACACATG
Sequence Type genomic DNA
Unitrap ID UNI1308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122935885..122936089 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es