Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14427F8
Clone ID IST14427F8
Vector VICTR74
Project tigm

Sequence tag IST14427F8BBF1
Sequence
TGTTAGCAGCAGGGACCGAGCCATTTCCGCAGCCCAATAAATTAAAAAATTTTAAAAAGAAAATGAAGTTTCAAATTATG
GTAAGACCTAAAACTAAGAAACAGAAAGAGAAAACAGAACAATGCCTAAACTGGTAGGGTAGTCCAAAAATAACCATTAG
AGGAGAGCACAGTTCAGCTGGAAATGGGAGTTATCAGGAGCCAGGGTCAGGAAGAACCATGTGAGTGGGATTCAGGGAGG
TGGNNTNNNNNNNNNNGCCCGAGACAGGAANATGCACTGCACATCTGAGAACAACAAGANGCTCAGTGGGGCCAGANGAA
CTGGAGTGGGCAGAAACTGGATGTGACACGGTCTGTGGATATAATTTTTCGGGCTTTGGCAAATGACNANGTGGGATTTA
NTNAACNAGTNACNAGATCCAATGANTCTTTTTGTTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14427F8HMR1
Sequence
AAATAAATAATAAATAAATAAATCAAAACAAAAAATAGAAGACAGAGTCTGTGGCTCAGGAGAAGAGCACACTAAATTCA
AGCTCCGGGCATTTCATGAGTGCACACACACAGTCTCTAGTTCAGAAGGTAAATGTGTCTATCGGTGATAGCTGGGGTGT
CACAGTTGCCCGCTGGGAAGTCAGTGGN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71020344..71020530 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST14427F8HMF2
Sequence
ATTTTTATTTTGAGACAGGGTCCGAGTTAGTTACTCGGGCTGGCTTTGGAATACTCTATGATCCAGGCAGGCCTTTTAGC
TTGTGATTCTTTCCTGCTTCCGCTCTCAAATAGCTGTGCTAGCTACTGTATGCTGGATACAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71020527..71020671 145
 
EST/CDNA Est Name
  W70832.1 - W54597.1

 
Come back to gene W70832.1 - W54597.1


For any suggestions or comments, please send an email to unitrap@crg.es