Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13742C11
Clone ID IST13742C11
Vector VICTR74
Project tigm

Sequence tag IST13742C11BBF1
Sequence
CCATGTCAATAAACTCAGCCTGCTCTAGTTTTATGTTCCTTCCACCCTTATCCCACACCCTTAAAATCCATTCCCACACA
TATTCACCAGGTTTCTGCTTGAATGAATTAGCAAACTCATTAAGCTCCTTANTAGTGTAGCGAATTTCCTCATGGACTAT
ACTTTCTACCTCCCCTCTAGGAGCCTGTTTTGCTTTGAGTCTGGTTACAGGTCTAGAANAAACTATTGGTGGGCCGTGAG
CANACTCTGCAAAATTAATTTCCTCATGTGGGGAAGGCATTATTTCAAGAGGTGGGGCTGAGGGTACTACTTCCTNAGGT
GGGGCAAACCCTTGANAATCTGAGGATTNNAAT
Sequence Type genomic DNA
Unitrap ID UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16614717..16615064 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4761065..4761412 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22300376..22300723 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9515298..9515645 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18736071..18736418 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14981065..14981412 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16883490..16883837 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31823798..31824145 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17418016..17418363 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4663000..4663347 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32282618..32282965 338
 
EST/CDNA Est Name
  BY263328.1 - BU149825.1 - BY335821.1 - BY329225.1 - BB862628.1 - BY227476.1 - BY155011.1 - BY253858.1 - BY172576.1 - BY170793.1 - BY005361.1 - BY794820.1 - BY778245.1 - BY073912.1 - AI931477.1 - BY088039.1 - BY082454.1 - BB847162.1 - BY080325.1 - BY090298
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16246839..16247186 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35329824..35330171 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45682967..45683314 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62667972..62668319 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11075371..11075718 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13776890..13777237 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15696973..15697320 338
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14228756..14229103 338
 
EST/CDNA Est Name
  AV008224.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15515229..15515576 338
NO GENE  


Sequence tag IST13742C11HMF2
Sequence
CCATGTCAATAAACTCAGCCTGCTCTAGTTTTATGTTCCTTCCACCCTTATCCCACACCCTTAAAATCCATTCCCACACA
TATTCACCAGGTTTCTGCTTGAATGAATTAGCAAACTCATTAAGCTCCTTAGTAGTGTAGCGAATTTCCTCATGGACTAT
ACTTTCTACCTCCCCTCTAGGAGCCTGTTTTGCTTTGAGTCTGGTTACAGGTCTAGAAGAAACTATTGGTGGGCCGTGAG
CANACTCTGCAAAATTAATTTCCTCATGTGGGGAAGGCATTATTTCAAGAGGTGGGGCTGANGGTACTACTTCCTCAGGT
GGGGCAAACCCTTGANAATCTGAGGATTCNNNATTCTCANCTTCAN
Sequence Type genomic DNA
Unitrap ID UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32282618..32282982 351
 
EST/CDNA Est Name
  BY263328.1 - BU149825.1 - BY335821.1 - BY329225.1 - BB862628.1 - BY227476.1 - BY155011.1 - BY253858.1 - BY172576.1 - BY170793.1 - BY005361.1 - BG971146.1 - BY794820.1 - BY778245.1 - BY073912.1 - AI931477.1 - BY088039.1 - BY082454.1 - BB847162.1 - BY080325
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4663000..4663364 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17418016..17418380 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31823798..31824162 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16883490..16883854 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18736071..18736435 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9515298..9515662 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22300376..22300740 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14228756..14229120 351
 
EST/CDNA Est Name
  AV008224.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14981065..14981429 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4761048..4761412 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15696973..15697337 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11075371..11075735 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13776890..13777254 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62667972..62668336 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45682967..45683331 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35329824..35330188 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5143450..5143814 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16246839..16247203 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16614717..16615081 351
NO GENE  

 
Come back to gene AV008224.1


For any suggestions or comments, please send an email to unitrap@crg.es