Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0544
Clone ID AL0544
Vector pGT0lxr
Project sanger

Sequence tag AL0544
Sequence
ATCTTCCGTCCGCTCTATCGATGCTTCCGCCTTGGCCTGGCCTTAGCAGAGAGTATCTGTTGCAGTCATGTCGGCTGCGA
TTGCAGCTCTAGCTGCTTCGTATGGCTCGGGCTCGGGGTCCGAATCGGATTCGGACAGTGAGGGCAGTCGGTGTCCGCTG
CCAGCCGCGGACTCTCTCATGCACTTGACCAAATCGCCTTCAGCCAAGCTCTCTCTGACCGTGGCGGTGGACTCGGCTCC
GGAGGTGGCAGTTAAGATCTGGAGACTGGAGTTCACCTTGACCCTGCTGTCAAAGAAGTTCAGTATAATCCCACCTATGA
GACCATGTTCGCTCCTGAG
Sequence Type mRNA
Unitrap ID UNI2671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40587630..40602925 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038446 (Cdc40) NP_082155 cell division cycle 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918963]

 
Come back to gene ENSMUSG00000038446


For any suggestions or comments, please send an email to unitrap@crg.es