Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14171C11
Clone ID IST14171C11
Vector VICTR74
Project tigm

Sequence tag IST14171C11BBF1
Sequence
AGGGTGTTNTANAGGACCNCTGCAAATACTGTTCCTCTTANGTACAAAGGAAAATGCTCTACTTANGAAAAAAATAGGAT
AAAAACAATAAAATAATAAAACAATTTAATGTTTAATAAAATAAGACATTTGCTATCATATCAGGTGGACATATTTAGCT
GTTCCTCTCTGACAAGAATCCTCAAAGCCTTTATAAAACATTAGGAAATAAATACTACCCTTCTTTGCTAAACTATTGAC
TAGTTTTGAGCTTAACACAGTCCTAAAATAAGAACACCAGCAGCAATCCCAAGCTTAGCTTCAACAGTGGAGTTTTATGC
TAAGGTCTCCTCTCAGCTACTTAGTGCTCTAAATAAAGGGGGTTGGGAGTAGCANCCCTTCCAGAAGCCAGGCAGGTTGG
ACTTGACAACCTTGCATTCCTATAACTACAGTGGGAGANCACTTTGCTAAATGTTACTCACTTTTTCTGGTCTACNGGTG
GANTTACTGAAACTGCCAATTCTNNGNCTNNNANGNNTCCNGTAAAANCANCCNTNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53954955..53955487 491
NO GENE  


Sequence tag IST14171C11HMR1
Sequence
CCCTCTCTGATGATCAAGGTCAAAAATCAAATAAGCCCTCAATTCGGAGGCTGTAAGTCATTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53955484..53955550 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es