Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7881-NR
Clone ID PST7881-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7881-NR
Sequence
CTTTGTCGGTTGGTTGGCCAGACCTAAAATATTTACCATCTGGCCCTTGATAGTGTTTGAGAACACCTGTTGGAAGGCAG
AGAGGGATTTCTGAGGGACAGAATGACTTCCTGTGCTGACCTTAAATAGGAAGTACGTAGTGAAAGGGCATTCCTGGTAT
GTTAAAGCAAAAGTGAGTGTGAAGTGAATGAACCTTGGTTTGCTCTGCTTCATCAAAATAGCAATTAGAATAAGTTAAAC
TGATTGCTTTGGTGCTGCTGATGTCGGCTGTGCAGG
Sequence Type genomic DNA
Unitrap ID UNI14824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99031700..99031975 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041747 (Utp15) NM_178918 UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443]

 
Come back to gene ENSMUSG00000041747


For any suggestions or comments, please send an email to unitrap@crg.es