Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7737-NR
Clone ID PST7737-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7737-NR
Sequence
AAACCATCACGCTCGAGGTACGGGCCACCTTGCCGTTGAGGAAGCCAAGGCCTGACTGAGGCCCTTAGTGTTTGAGGGCG
GGTTTCTGAGTTTTGAGTTGTGAAACTTGGCTTTGAGCTGAGATTATGGTGCTTAGCAAAAACAACGTTTGGTTTTCGGT
GTGGTACGGTTTAGCCTGCTTTATCCCGAGTGGCGAAATGTAGGGTAGGTGATGGGAGACGCTTTTCTCCGGGCAGACGC
GTTCCTGTGCTTCCCCCCGCCGTCGCTCGCCCCTGGTATGGGG
Sequence Type genomic DNA
Unitrap ID UNI15305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29447417..29447697 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020460 (Rps27a) NM_001033865 ribosomal protein S27a Gene [Source:MGI (curated);Acc:Rps27a-003]

 
Come back to gene ENSMUSG00000020460


For any suggestions or comments, please send an email to unitrap@crg.es