Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11024A6
Clone ID IST11024A6
Vector VICTR76
Project tigm

Sequence tag IST11024A6HMF1
Sequence
GGATGGGCCTTCAATATTGACCTACACCACTCCCCCTACACCTTTCCTCCTGTCGGATGGCCCATCAGCACACACACACA
CACACACACCCGCTGAGCTGTGAANCTTTTAACAGGTCATGCCTNTTTTATTTAGTGTGTGTGCACACATATGTATCAGT
GCTCCTGTGTATATCGTGGTGCATGTGTGGAGGTCANANGACCACTTGTGGGTTGGCTCTCTCTTTCCACCATCTCANTC
CTGGGCATTAAGCTCANGCATCANCCTTGCTGGCAGTGGACTTTCTTCCTCCCCTCTCCTGTCTTTCATTCCTTTGCAGT
GTTGGGGATGGTGCCATTANCTGCCCATGCTANNCTGGTGCTGTGCTGCTGANCTGTANCCCTANTTGATGAGGCTGACC
TGGCACCTGTGTTGTANNCAAAGTCNAN

Sequence Type genomic DNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21260187..21260611 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]


Sequence tag IST11024A6BBF1
Sequence
GGATGGGCCTTCAATATTGACCTACACCACTCCCCCTACACCTTTCCTCCTGTCGGATGGCCCATCAGCACACACACACA
CACACACACCCGNTGANCTGTGAAGCTTTTAACAGGTCATGCCTNTTTTATTTAGTGTGTGTGCACACATATGTATNAGT
GCTCCTGTGTATATCGTGGTGCATGTGTGGAGGTCANANGACCACTTGTGGGTTGGCTCTCTCTTTCCACCATCTCANTC
CTGGGCATTAAGCTCANGCATCANCCTTGCTGGCAGNGNACTTTCTTCCTCCCCTCTCCTGTCTTTCATTCCTTTGCAGT
GTTGGGGATGGNGCCATTANCTGCCCATGCTNNNCTGGTGCTGTGCTGNTNANCTGNANCCCTANTNNANGANGCTGACC
TGNCACCTGTGTTGTANCCAAAGTNAACCTTGACATTCTGAGTCTNCTACTTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es