Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14485C4
Clone ID IST14485C4
Vector VICTR74
Project tigm

Sequence tag IST14485C4HMR1
Sequence
GGTTCCTCAGACAGAACTGAAACCNTAGCACGCTACAGTGAGAAAGGACACAGCACAGGCTGGCTTTGGGGAAGAAGCAG
TGACTTTTCACCTGTAAATTGTCGCAGTTCCCGTGTTGGTGAAGTGCAGCGTGCCTCCCCTTACGTTTTACTTGGGGGTC
ACTTCTCCGAAGCAAATGCTTGAGACTTTTTCATGTTAAGTCATTCCTGGAGATATCTGCTCTGGGCTGTTANATAANGC
TTTTTGGTAGTTTAATAACAAGTCTGGGCTGCTGTTATCTTAATCCTTTGTTTGCTTNANTAN
Sequence Type genomic DNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83290983..83291284 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]


Sequence tag IST14485C4HMF1
Sequence
NAACCAAGCGCCCATTTCTTANAAGCCNGGACCGCGCACGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TNTNTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83290907..83290986 76
NO GENE  

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es