Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14682A7
Clone ID IST14682A7
Vector VICTR74
Project tigm

Sequence tag IST14682A7BBF1
Sequence
GAAAACTGAATTAGCAAACAAAACTTGCCTGTGCCCTCAGGCTAAGACTTAACTAACTCAAGAGAGTACAAATGGCTCTT
AGATTTGTTTGGGGGTCGGGAGTGTTATCAGCAGGAGTTCTACAATTTAGCTCCTCTTCGAAAATCCCAAATCCCATGAA
AAATACACCGAAATGGTAAGGAGACGTTCCCTGTCTATCCCAGTGTGCATGCCCTGGTCACGATGCAAACCTCAACATGA
GGACTCTTTCCCAACCTCTTTATGAAAGGTACTTCTTCAATTCTTCAACCACCTCTTGAGGCTCAGGAAATTTGAGCTTT
CGTGGAGGGCCCTTCTTAATACCAGTCCAGAGTTCAACACCTGGGAAAGGATGGGATAAAGCCNAATTATGGTGGTACTC
ATTGGTACCCCCTCCCNTCAGTTATCNNGTGGCCNGNNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509914..84510347 426
 
EST/CDNA Est Name
  AK167638.1


Sequence tag IST14682A7HMR1
Sequence
TTTTCNNCCTCTGGTGTTATTTTAATTCTATGAGTCTATTGCAAATCAATAAATTCAATAAAGTGTGGCTTACTTGTAGT
TAAGGTTTTTCTCCCTTGTATTGACAGCCTCTTTGCTGTTACTTCACTTTACCTGGCTTTTCTGTGTTTTGTTAGTAATC
TGANATAANATAGCCTCAACCCATCCCGCTCGTACCCCCACTTCTTGGTTACATGGATTTTATTTTTGTCCCGTGTTTCA
TGCATGTTC
Sequence Type genomic DNA
Unitrap ID UNI34515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509671..84509918 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076437 (2700094K13Rik) NM_001033166 RIKEN cDNA 2700094K13 gene Gene [Source:MGI Symbol;Acc:MGI:1919907]


Sequence tag IST14682A7HMF1
Sequence
GAAAACTGAATTAGCAAACAAAACTTGCCTGTGCCCTCAGGCTAAGACTTAACTAACTCAAGANAGTACAAATGGCTCTT
AGATTTGTTTGGGGGTCGGGAGTGTTATCAGCAGGAGTTCTACAATTTAGCTCCTCTTCNAAAATCCCAAATCCCATGAA
AAATACACCGAAATGGTAAGGAGACNTTCCCTGTCTATCCNAGTGTGCATGCCCTGGTCACNANGCAAACCTCANCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509914..84510147 222
 
EST/CDNA Est Name
  AV293296.1 - AV290273.1 - BY497255.1 - BB407652.1 - AV145489.1 - AV069704.1 - AV215051.1 - AV109622.1 - BM933631.1 - BM938852.1 - AV105304.1 - AV218418.1 - AV070215.1 - AV217034.1 - AV146869.1 - AV114133.1 - AV213649.1 - AV294915.1 - AV300140.1 - AV063246

 
Come back to gene AV293296.1 - AV290273.1 - BY497255.1 - BB407652.1 - AV145489.1 - AV069704.1 - AV215051.1 - AV109622.1 - BM933631.1 - BM938852.1 - AV105304.1 - AV218418.1 - AV070215.1 - AV217034.1 - AV146869.1 - AV114133.1 - AV213649.1 - AV294915.1 - AV300140.1 - AV063246


For any suggestions or comments, please send an email to unitrap@crg.es