Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14430A12
Clone ID IST14430A12
Vector VICTR74
Project tigm

Sequence tag IST14430A12HMR1
Sequence
CCCACTGCTCCTTTTTANGTTGGAAGCAATACGATGGGCAGATCGTCCTGTATTCCTTCCTTGCCCTCCCGACCAGCCTG
GGCCAGTTTCATTAGTGTTCATTTGCTGGGCACGGCTGGGGCAGGGTCCAGTAAGTTCACAGTCTGCATGGATAATGTTG
CTCAAACACAACATGTATCAAATAATTTGGCCTGTTCTCTGGANTTTTGTANAACCTTAAAAAAAGCTTGAAAACACATC
NNCGCCGTAAAGCGCGGTACACCTAACGGATGTAAAGGGTCNGGANANGCNTGTACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8973040..8973338 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]


Sequence tag IST14430A12HMF2
Sequence
NTGGCAACAGGCTGCTTTTTTACAGGCTGGGATGCATTTCGTCCCCCTACCTGCCTCGACAGCCCTGCGCACTGCAGGAA
GGAGACGAAAGCATTGACCACCCCGAACCGCCAAGGGAGAAGGGGCGGCTGGGAGCGGACAAGACCGAAGACAGCACCCA
GCTTCAGCCTTTCTAAGCCCGGCGAGATTCAGGAACCCCACAGACAAGGGCCGCANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8972826..8973039 214
NO GENE  

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es