Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13200E10
Clone ID IST13200E10
Vector VICTR74
Project tigm

Sequence tag IST13200E10BBF1
Sequence
CTTATAAATTCCCTCCCTAAAATCCACAGGAGAGCCGGGCAGTGGTGGCGCATGCCTTTAATTTCAGCACTCGGGAGGCA
GGAGACAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGAACAGCCAGGGCTATACAGAAAAA
CCCTGTCTCAAAAAAACAAAAACAAAAAAACAAANNTCAGGGGCTGGTGAGATGGCTCAGCAGGTAANAGCATCCGACTG
CTCTTCCNNNGGTCCTGAGTTCAAATCCCAGCNNNCACATGGTGGCTCANNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84863069..84863357 271
NO GENE  


Sequence tag IST13200E10HMF1
Sequence
CAGGTTTAACGCTCCTGACAGGAAATCCGGGTTTTTGGATCCCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28117080..28117127 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es