Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12411A10
Clone ID IST12411A10
Vector VICTR76
Project tigm

Sequence tag IST12411A10HMF1
Sequence
TAACATTTCCGCCACACTCAAAATGACTGAAATACTGTAAACCTTTTCAATGCATCCGGGTGGTCGTNTCCNNNNCTCCT
GTNNCTTCCGCCNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12411A10BBF1
Sequence
TAACATTTCCGCCACACTCAAAATGACTGAAATACTGTAAACCTTTTCAATGCATCCGGGTGGTCGTGTCCCTAGCTCCT
GTTACTTCCGCCACTCTCTGCGGGGCGGGGCGCTCTGCACTTTTCTGCACCTCGCAGCATTCAAGATGGCCCAGCTTCCT
CCCACTTTTCATTGGCCAAATCACCTAGCACGAGGGTGGCTGGGACTGGTATTTGACTCACAGTTCTTTTGACCAATGGA
CAGAAAGTAGGAGCCAATGAGGCGCGGGAGCTGGAGACCCTCCCCTGCATCTGGGCGGGCCCTTTGCCTGGGGCGGGGTG
GAGCCGAGCCGGAAGCGGGAGGGCAGAGCGAAACAGGAAAAGAAGGGAAGGANGAAGCAGANGGAAGAAGAGAGGGAGGA
GGAGGGGTGGCGGCGCCGTGGCGGANGAGCANGANCAGGANGGGGATGGAGAGGANAANGCTCCTGGGTGGCATGGCGCT
CCTGCTCCTCCNNGCGCTGCCCAGCCCCCTGTCAGTGAGGGCTGANCCCCCNCAGNTANNGGNAGGGCTTCTGGGCTN
Sequence Type genomic DNA
Unitrap ID UNI35053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 46673249..46673805 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047731 (D19Wsu162e) NM_146099 Outcome predictor in acute leukemia 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BGW2]

 
Come back to gene ENSMUSG00000047731


For any suggestions or comments, please send an email to unitrap@crg.es