Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10752-NR
Clone ID PST10752-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10752-NR
Sequence
ATCCCAAGCTTGTCATGCAGAGCTGCTGGCCTGGAGAGGGCTGGTGGGTGATGGGCAAGCCTGAAGTAGCCAGGCAGACT
CCATCAGAAATGGCTTCTTGGGCTAGGGGTGTATCTTAGTGGGTAGCATG
Sequence Type genomic DNA
Unitrap ID UNI9459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127548600..127548729 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es