Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10714G6
Clone ID IST10714G6
Vector VICTR76
Project tigm

Sequence tag IST10714G6BBF1
Sequence
TTATCTGTGTCTCACTCTGCAAAGCCCTGTCCANAGCTGGACTTGGCCAGTACTTATTTTAGCAGGCTCCGGGCAGGAGC
ATTCTTTCATAGAAAATCCTCCTGCCATGGCTTCTTGCACTCCACTGACACATCATTGCTGGACTTTGTTCCTCCAGCAN
AAATCACATTATCTTTTGTAAGAGAGGCNTANAAAACTGCACCATTAAAAAAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55018997..55019213 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST10714G6HMF2
Sequence
ATATCTGTGTCTCACTCTGCAAAGCCTTGTCCAGAGCTGGACTTGGA
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55018996..55019041 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es