Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14872B9
Clone ID IST14872B9
Vector VICTR76
Project tigm

Sequence tag IST14872B9HMF2
Sequence
NNNNNNAATATTTTTNNGGANCNCCNNCNNNNNNANATNNNNTCNNGGNNNNNNNNNNNCANCTTTCATANNGCTTCTAG
TTCACCATACCAAGAAAGGTGGAGTGGAGTTCATGGCAGTGGGAACATGATTATTCTCATGGTGCCTGGTCAGGGATGCA
GGGATGCCTTGCATAAAACCTCCAGCCATTCTTCTAGGCTTCACATTGCCACCANCTGGGGCCAAGTATTCAAACATGAN
CCTGTGCANGCATTTTATATTNNNACCATNAN
Sequence Type genomic DNA
Unitrap ID UNI2404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111234125..111234321 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]


Sequence tag IST14872B9HMR1
Sequence
CAATGAGTACCAGGCTACCCTGATACTAGAGTTAATCCTTGTCTCAAACAAACAAGCAAGCAAACAAGGGGGAGGACAGA
CCTATGTGTAACCTAAAACAAAGAACTTTTCTTTTATAAAGAGCCCATACATTATCAGAAAAATTTGCATAAATAGGACC
AAGTGGGCACAGCTGTGAGAACTCAGGTTGTCACCACAGACTCTGTTCTTTTCCAGGTAAACACACAGACNTNNNNNNGC
ANCTTGCCNCCNNTTTCACCNGANACCATCCGGAGTCNCTGGANAANGCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14872B9BBF1
Sequence
ATTGTATATCTAGTCTGCTCTCAAACACCTGCCAGAAGGAGGTTAAGGGAGGAGAAGTTTATTTTGGCTACAGCTTCTAG
TTCACCATACCAAGAAAGGTGGAGTGGAGTTCATGGCAGTGGGAACATGATTATTCTCATGGTGCCTGGTCAGGGATGCA
GGGATGCCTTGCATAAAACCTCCAGCCATTCTTCTAGGCTTCACATTGCCACCAGCTGGGGCCAAGTATTCAAACATGAG
CCTGTGCAGGCATTTTATATTCAAACCATAACCCTGGCCAGGTGTANGGTGCANTCTTATTTCGGAACCTGGAANANANA
ANCNNANNNATCTG
Sequence Type genomic DNA
Unitrap ID UNI2404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111234073..111234393 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]

 
Come back to gene ENSMUSG00000029512


For any suggestions or comments, please send an email to unitrap@crg.es