Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13320D2
Clone ID IST13320D2
Vector VICTR74
Project tigm

Sequence tag IST13320D2BBF1
Sequence
AGAAAAGTATTTTTGGCAAACGTCAGTTTTTTAAAAATAAAGATTTCCAACAAGTGATTCNGGTCNTGTANACAAGACCA
AAGACATCGTGCATGAGGCTCGTGAANCANTAATTCCAGCCTGTGGCCCAAAGCACACTAGGAAAAAGTAATTTGGATTT
ANGATTTATAATANACTTTGCGGGAAATTCCNCTNAAACACTAATTATGAATCNGTGTATTANGCNNNANTGTTTNCCAN
NGTGGANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13320D2HMF1
Sequence
AGAAAAGTATTTTTGGCAAACGTCAGTTTTTTAAAAATAAAGATTTCCAACAAGTGATTCTGGTCATGTAGACAAGACCA
AAGACATCGTGCATGAGGCTCGTGAAGCAATAATTCCAGCCTGTGGCCCAAAGCACACTAGGAAAAAGTAATTTGGATTT
AGGATTTATAATANACTTTGCGGGAAATTCCTCTAAAACACTAATTATGAATCTGTGTATTATGCAGCACTGTTTCCCAA
GGTGGATTTTAAAAAAACAATTNNAATTGATCTCTGATGGAATATTATATTTACACGTCATCATGAAGACATCATTTGGC
AAGAGTTTTGAATTANAAAAAGANGTTC
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17980005..17980351 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es