Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10480B5
Clone ID IST10480B5
Vector VICTR76
Project tigm

Sequence tag IST10480B5BBF1
Sequence
ACATGATGACTTTATTGATGAAAAAAGATACTCTGACAGAAGAGGAGACTCAGTTTTATATAGCAGAGACAGTATTAGCC
ATAGACTCCATTCACCAGCTGGGATTCATCCACAGAGATATCAAGCCAGACAACCTTCTCTTGGACAGCAAGGTATGTGG
GCACACAGCACCCTGCCCAGCGTGTCTGCTCGGCTGGGCAGTGCTGTCTTGGAGTGATCTTTTGTATGTTTTTGTTCATT
TTACAGGTAAGTTTGCCNTCACATCCTGTCTCTGAACTATGATTCTGTAATTTAATCTAATGTCCTTTAAAAAAAAGCAG
GCACGATTTGAATCCCAGCTTTCAGTANGTAAAGCCNAGCTGGTCTACACAGGGAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29118747..29119128 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es