Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14445G3
Clone ID IST14445G3
Vector VICTR74
Project tigm

Sequence tag IST14445G3HMR1
Sequence
AAGTAATGACACTGTTTATCTGTTGTGGACAACTTGTTGATGGTTCAAGAAGTAATGACGGATTCTACCATGGGGCTTCT
ACCTGACTGCTGTTCCCATTTGAGTATGGCGTTTGTTGTTGGTTTTTGTTTTTGGTGCTGAGGATTAAATTTAAGGGTTT
TTGTATTATAGGCAAATGTCTTGTATCCTANTATATACACAGGCGTTGTGTTTTACTAATTATTTGCAN
Sequence Type genomic DNA
Unitrap ID UNI13336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79948539..79948766 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017550 (Atad5) NM_001029856 ATPase family, AAA domain containing 5 Gene [Source:MGI (curated);Acc:Atad5-001]


Sequence tag IST14445G3HMF1
Sequence
NNNNAAAAAANAANAACAANNNNNNNNNNNNANTTCCNATGGTGAACNNNNNACCCTATACTTCTGGGCATCCCTTCCAT
TCCCTCAAGGAGATCTCTAGAATCTTTGGAATACCAGACTTCCTCATGACGTGACATATCCCTTCATTGTGTGCAATTGG
ACATATGGAGGTTCCCTTTGCATTTACAGACATTACCCCACACTCAGCCCATCCCCAGATCCATGTTCTCAGGCCCCAAA
ATTCTCTTTTGTGAGACACCCAGAAAAGGACCTCGAAGTCATCCCCTCCCCAGGGTCTCAGTGACCCGGANCCCAGAACC
CTGCGACCCCTCCAGGTTGCNCCTCCGGATCCGGANNACCGCNCCTCCCCNAAGCCTCCATTTCACAAGGCCTCACNCTC
CANTCCCGTGACTNNANNNCATGGGACTGGGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14445G3BBF1
Sequence
ACAGAAAACAGAAAAACAAGCAAACAATCTTAGTTCCTATGGTGAACCTAAAACCCTATACTTCTGGGCATCCCTTCCAT
TCCCTCAAGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52715702..52715797 96
NO GENE  

 
Come back to gene ENSMUSG00000017550


For any suggestions or comments, please send an email to unitrap@crg.es