Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11560B8
Clone ID IST11560B8
Vector VICTR76
Project tigm

Sequence tag IST11560B8HMR1
Sequence
CTGCACAGCAGAAGTTACCAACTGGTTGGGAAAGGAGAGAGGTAGCTGCTGTGGGCCNTCTGTAGTGGACGGTGCTCATA
GAAATCATTTGCCCTGGGGTGAGATAGGAGGTGTCCTTCCGGGACC
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52177629..52177754 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]


Sequence tag IST11560B8HMF1
Sequence
NAGGCACTCACACCTATGGGTTCCTCAGAACACAGCANCANTGCANTGTGGGGATACTANCGGAGGACTGGTGCCCAAGC
ACCAAGTATACACAGCAGGGCCGCANAACACCAAAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es