Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12016C6
Clone ID IST12016C6
Vector VICTR76
Project tigm

Sequence tag IST12016C6HMF1
Sequence
GGGAGCAGATGTTTGCCACAGGAGTGGCCGTGTTTGTAGAGCTTCGTGCCTAATGATTCATAGTACAGCCTAAGGCAGTT
TTGTAACTGACCGTACATCCATGATTTGGCAAGTCTCAGGGTTCAGGCTGCCTTTCACAAGTTGCTGACCCACTTCAGAA
CTTGCCTAGGATAATTCGAGTCTCCTGTCCTTGAGACTAACCCCTCCCGGTCAAAAGCAAAAGGCTGCAGAAGGAGAATC
AAGGTGGAAAAAAAATGCCTTCATGATAGTAAAATTCCACCTTGTGGAATTTCCCCAAAGTTGANTAACCCGAAAAGTCT
AACAAAGTTCTTGGACAGGAGAGCACCTTTGTTTTCTANAGGCTGGCAGGGACNACTCTCCTGTGGGAGGCAGATACAGG
TAANAAAGGGCCTTTAGCATANGCTTTCACCACAGTGTACACAATGGCACATTTACATCCCGANCATTCNNNNGCAGANT
TCCTGGNGTTTGGGCTGGGTTTATATCTGTTANNNNTGGCTTTTGNAANNTGNNNTCCNNNGNNCC
Sequence Type genomic DNA
Unitrap ID UNI8149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27807292..27807819 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es