Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13665C11
Clone ID IST13665C11
Vector VICTR74
Project tigm

Sequence tag IST13665C11BBF1
Sequence
TTTTTAAAGATTTATTTATTATTATATGTAAGTACATTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15349 UNI21417 UNI31123 UNI33706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 39085459..39085536 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119939594..119939671 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107394785..107394862 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85653224..85653301 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072946 (Ptgr2) NM_029880 prostaglandin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1916372]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101391353..101391430 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021635 (Rad17) NM_011233 RAD17 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1333807]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 51854718..51854795 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3206568..3206645 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29495748..29495825 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32972357..32972434 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140337597..140337674 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28945510..28945587 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078775 (Fcgbp) Fc fragment of IgG binding protein Gene [Source:MGI Symbol;Acc:MGI:2444336]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273181..3273258 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70565946..70566023 78
NO GENE  

 
Come back to gene ENSMUSG00000078775


For any suggestions or comments, please send an email to unitrap@crg.es