Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13545D11
Clone ID IST13545D11
Vector VICTR74
Project tigm

Sequence tag IST13545D11HMR1
Sequence
TCTNNNAANGTCTGGGACAACCAGGGCTACACAGAGAAATCTTGTTGGGGGTGGAGAAAGAGGCCAGAAAATAAATAAAT
AAAGTAAAATAAATGAATATAAAATAAAAAATCATGTGCCAGCATGTCTGGCTTTTAACATGGATACTAGAACTAGAACG
GAAGTCCTCGCACATGCATGGAGAATCTTAGTTATTTGCATGTGGTTGTACAAAAGCATCCAATGCTTCCCTCCTTCTTG
TGTGAAATAGAGGTAGGGTGATATACAGATCGTAAGCTATTCAAAACAGGGCTTCTTAGTCCTGTGCAGTGGTATACCCT
AATGAAATATGGACAGGCCAGCTGGAGTCTGGAAACCAGGTGACCTTGAGAATAAAAACTCATAGCTAGGAAACCTATCT
CTGCCATCACAATCAGCAGTAAAGGACCCTCCACGTGTGCTCTCAGGGAAAAGAGAACTCAAATCTGACTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165570..154166033 462
 
EST/CDNA Est Name
  BB788239.1 - BY659288.1 - BB738210.1 - BB834332.1 - BY544012.1 - BY559565.1 - BB791328.1 - BY762644.1 - BB329807.1 - BB733529.1 - BB311779.1 - BB313784.1 - BB735652.1 - BB773411.1 - AI152002.1 - BB230821.1 - BB352498.1 - BB038133.1 - BB218147.1 - AA929787


Sequence tag IST13545D11BBF1
Sequence
CCTTAATAGACAAGATTGGCCAGGAACTCANAGATTTGCCTGCTTTTGCCTCTAAAGGCATAAGTTACACTGTTTGTTTG
TTTATTTGTCTATCTTCT
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165476..154165573 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es