Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11563B5
Clone ID IST11563B5
Vector VICTR76
Project tigm

Sequence tag IST11563B5HMF1
Sequence
CNNANGTTGGCTCCATGGTTTACATTTGCCATTGGCATTTTCN
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114472383..114472419 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST11563B5BBF1
Sequence
ATCTCACCATAGGTTGGCTCCATGGTTTACATTTGCCATTGGCATTTTCCATTTCTTTCTTTTTTTTTTNNAA
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114472371..114472439 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST11563B5HMR1
Sequence
NATGATGTCTCAAGTGCTAAGAAGAATCCCAGTTAATTCCCTGAAAGGCTGCTTGCTCCCTGTGCCTCCATTCAAGTCNC
AAAGATCCAGGCAACACCCTTTCTCCAGTGGAGGAACTGACCAACAGTAACGCCAAGTCTCAGTAAGAGCCAGGTGCGGG
ACTCACTATGGCATTANTTTTANCTTCCTTCTCTATCGTCCTGTGAACTGGGGAAGGCTGACCTAGGGCTCATGTGAGCA
CCACTCACGGTGGAATTGCCTTCAACTCTGAACCAAAGGCAGGCCATGGANACACTGANTCATAAATANGCTGGCGGTGT
GATGACCACCTGGCCNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114472039..114472372 322
 
EST/CDNA Est Name
  BB421125.1 - BE199976.1 - AW823507.1 - CR518704.1 - AU016648.1

 
Come back to gene BB421125.1 - BE199976.1 - AW823507.1 - CR518704.1 - AU016648.1


For any suggestions or comments, please send an email to unitrap@crg.es