Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10062F8
Clone ID IST10062F8
Vector VICTR75
Project tigm

Sequence tag IST10062F8HMR1
Sequence
CCACCACAACGACAACAACAAGAATTCGGGGCTCGGCCCACAGGGCCCAGAAATTAAGCCATAAACAAAACCAAACCCCC
ATGAAGTGTTGGAGAGGCAGCATCAGTCACATGGGCAAAGGCCACAAGCCACGCAAGGCAGACAACAGATAATCCACACA
GGGTTGGCCTTCCCCCGCCCCCTACTTTGATTAGTTTCTGGAGGAAAAAAAAATACAAAAATAAAAACAAACACCCCCCC
CCCN
Sequence Type genomic DNA
Unitrap ID UNI9918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 119485278..119485520 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028134 (Ptbp2) NM_019550 polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

 
Come back to gene ENSMUSG00000028134


For any suggestions or comments, please send an email to unitrap@crg.es