Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10086F8
Clone ID IST10086F8
Vector VICTR75
Project tigm

Sequence tag IST10086F8BBR1
Sequence
ATCTCCATCTCTCATTCAGTTACTGGTAGAGCCTCTCAGAGAACACCCATGCTAAGCTCCTGTCTGCATAGCAGGCATAG
CATAGCATCAGTAATAATGTTAGGGTTTGGTGACCACCCAGGAGATGGATCACAAGTCGGCCAGAAAGTATTCAGCCATT
AGTTTGTGCTCTCCTCCATTTTTATCCCCAAATTCTTTTGAGAAAGGAACAATTTTGAACGGAAAATTTTGAATGTGAGG
GCCTCCACTGGGGTGGAGGTGGTCTCTTCAGGTTCCTTACTCCCTTTATTGCACTTTTGACTAAGGTTACCCCATTGTGT
CCTCAGAGCCTCCCCTTAGAGTTTCTACTCTAAGGGAATTCTTCTCAGTCATTGGTATGCCAAATGTCAGTGCCTGTAGT
AACAAAGCTAGCTCCTAAATAATTGAAACTGGACCATTATATTCATTTATTTATCAAGCTTTAAAGGAACGATAAGCAAG
CATTTTTCTTCTATTTTCATCCTCTGAGTTTATCTGACCAATTCCCAGTCAAAACTCCTGTGATACTGCATTTTTTTTCA
CTGATCC
Sequence Type genomic DNA
Unitrap ID UNI31027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17218293..17218857 560
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067034 (Zfp97) NP_001005358 zinc finger protein 97 Gene [Source:MGI Symbol;Acc:MGI:105921]

 
Come back to gene ENSMUSG00000067034


For any suggestions or comments, please send an email to unitrap@crg.es