Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14890B11
Clone ID IST14890B11
Vector VICTR76
Project tigm

Sequence tag IST14890B11BBF1
Sequence
ATATTTATTGGTCCTTGTTTGTGGAACATTTAGAGAACTGAAGAAAGCTTTAGCGTATTTCCCAGGGGTCTGTGCCTGCA
AGATGCACGTCTTTATTCCTTCAGTCCCTCCTTTAAAGGCCCTCCTGTCCTGGTCCCTCTATTCTGAACAAACTTGGTTT
TTTCGGCGGCTGTCTGACCTAATGGTTTTGCTGGGTAAACAGCAGAGGGGTGATGAGCGCAGTGGGAGACATCTGCCCAT
GGGGCTGAGAAGATGCACAGGTCGGGGTGTTGGAGAGAAAGGCGGTTCTCATACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90498769..90499062 294
 
EST/CDNA Est Name
  CA878533.1 - AA919678.1 - BY300267.1 - BY283040.1 - BY322073.1 - BY334447.1 - BY013698.1 - CJ064381.1 - BY303249.1 - CF908282.1 - BY016592.1 - BY346148.1 - BY345341.1


Sequence tag IST14890B11HMR1
Sequence
TATTAAATANCACTGAGAGCAGATTCGGAGGTTAAGCATCAATGAATTTACACAAGTCTTGTCCTTGCATAAGTTTAATT
TTAATATGACTTCTCCGTAACCTGATGGCCCTATTTCGTGAATGGAAATCACAGTAATTCAAGGAGGGTAAGAATATAAT
ATGATTTTTGCCATTGCTTGAAGCATANTAAGAATTTTATAAAAGTTANGTCATTTCTTTTTCAAAATAATGGTTTGGTT
TTATTAATTCTTTGANGGTATTTTACNNNGN
Sequence Type genomic DNA
Unitrap ID UNI31861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90498506..90498771 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020546 (Stxbp4) NM_011505 syntaxin binding protein 4 Gene [Source:MGI (curated);Acc:Stxbp4-001]

 
Come back to gene ENSMUSG00000020546


For any suggestions or comments, please send an email to unitrap@crg.es