Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635F8
Clone ID IST14635F8
Vector VICTR74
Project tigm

Sequence tag IST14635F8BBF2
Sequence
CAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCAGAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50759762..50759813 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30730135..30730186 52
NO GENE  


Sequence tag IST14635F8HMR1
Sequence
GGAACTCACTTTGTAGACNNGGCTGGCCTCGAACTCAGAAATCCGCTTGCCTCTGCCTCCCGAGTGCTGAGATTAAAGGT
GTGCGCCACCACACCCTGCTCTTCGTTGGGATTTTATTGCTGGTAAGAGACACCATGACCACGGCAGACATTTAACTGGG
GCTGAGTTACAGTTTCAGAGGTGTAATCCATTATCATCATGGTGGGAAGCAGGGCAGTATGCCGGCAGACATGGTGCTGG
AGTGGGCCGAGAGTTCTACATCTTCATCTGANNGCAGCANGAGATTGTCTGCTGCANGCAGCCAGTAAGANGGTCNCTGG
ATCACATTAACCANACATAATCNCATATATGAGATCTCAAAGCCCTGTCTCTACAATGTCACCCTTCCTCTAACAAGGCN
NNGCCTCCTCCAATAANGCCNCACCTCTTAANAGTGCCAGTTCCCTTGGGCAAN
Sequence Type genomic DNA
Unitrap ID UNI33340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729683..30730135 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST14635F8HMF3
Sequence
CAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCAGAAAAAAAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50759762..50759813 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30730135..30730186 52
NO GENE  

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es