Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6243-NR
Clone ID PST6243-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6243-NR
Sequence
GTGCCAAGTTGCTATATCATGTGATTGTTTGTCTCTGATTAGCTACCTTAGTTTCTGGATTATAGTAGGGCTGCTAAGAA
GTCCCCTGATCTCTTCATGGCTGCTTTCACATTCTGAGGTGCAGTTTGCTGGTTGAGTAGGATACCATTGGAAAGTGGTG
CTTGTCTCCCCTCATAGAAACAGTGTTGAAGGTATGACTGACTAATTCTCTATCTACCCAGTCTTTTGATTGACTGTCTT
CTTTCAGATGAAGGCTTGAC
Sequence Type genomic DNA
Unitrap ID UNI14745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98634580..98634838 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es